View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17877_high_11 (Length: 356)
Name: NF17877_high_11
Description: NF17877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17877_high_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 24 - 343
Target Start/End: Original strand, 42238194 - 42238513
Alignment:
| Q |
24 |
acgaagttcaccggcaaggtatcgccacccttgtcgccgctgttagcaacctttccggtgccattcactcattcattaattctgaacaccatggccaaag |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42238194 |
acgaagttcaccggcaaggtatcgccacccttgtcgccgctgttagcaacctttccggtgccattcactcattcattaattctgaacaccatggccaaag |
42238293 |
T |
 |
| Q |
124 |
ataaatattaagtaatatatgctagcttatcgatcttataatttattattgtgtgatttagaaaatcgtataatatttattggtcatgcattctttcacc |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
42238294 |
ataaatattaagtaatatatgctagcttatcgatcttatagtttattactgtgtgatttagaaaatcgtataatatttattggtgatgcattctttcacc |
42238393 |
T |
 |
| Q |
224 |
cacttataattcaattgtagtctagtatttttaagtcactttcaccaattgatttcacttgatgcatggtatatatatgttccattctttgatggtgaaa |
323 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42238394 |
cacttataattcatttgtagtctagtatttttaagtcactttcaccaattgatttcacttgatgcatggtatatatatgttccattctttgatggtgaaa |
42238493 |
T |
 |
| Q |
324 |
ccaatcctagtgtccctatg |
343 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
42238494 |
ccaatcctagtgtccctatg |
42238513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University