View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17877_low_15 (Length: 267)
Name: NF17877_low_15
Description: NF17877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17877_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 6 - 167
Target Start/End: Original strand, 51418647 - 51418812
Alignment:
| Q |
6 |
agtgataagaatttatttagttcgaatatcatcaaaacgatcgtaaaatata---tttgttagtatcatttattgataaaacgtttcctttaaaaaatta |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51418647 |
agtgataagaatttatttagttcgaatatcatcaaaacgatcgtaaaatatactatttgttagtatcatttattgataaaacgtttcctttaaaaaatta |
51418746 |
T |
|
| Q |
103 |
tttctattgtaa-aaattgataatttgagttcttataaattactaccaccatgtggttgttattag |
167 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51418747 |
tttctattgtaagaaattgataatttgagttcttataaattactaccaccatgtggttgttattag |
51418812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University