View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17877_low_17 (Length: 250)
Name: NF17877_low_17
Description: NF17877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17877_low_17 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 125 - 250
Target Start/End: Original strand, 32598146 - 32598275
Alignment:
| Q |
125 |
gctaccatcttttttatc----tatcatttttgtgttataaatctataaaaattttaattctaaagctatatgtatattctgttcaattgcaaccatact |
220 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||| ||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32598146 |
gctaccatcttttttatctatctatcatttttgtcttacaaatctataaatattttaattctaaagctatatgtatattttgttcaattgcaaccatact |
32598245 |
T |
 |
| Q |
221 |
aatgacaagaacatatgtccaaaattattc |
250 |
Q |
| |
|
||||| |||||||||||||||||||||||| |
|
|
| T |
32598246 |
aatgataagaacatatgtccaaaattattc |
32598275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 16 - 74
Target Start/End: Original strand, 32598086 - 32598144
Alignment:
| Q |
16 |
ttaacaatattctcaagtatatagttagaaggacgatagtactatgccgccaccacatc |
74 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32598086 |
ttaacaatattctcaagtatatagttagaaggacgatagtactatgccgccaccacatc |
32598144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University