View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17877_low_8 (Length: 436)
Name: NF17877_low_8
Description: NF17877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17877_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 97; Significance: 2e-47; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 46 - 178
Target Start/End: Original strand, 7339572 - 7339704
Alignment:
| Q |
46 |
actaattcgatgatttaatagcaaacacacctcggtgttttggcttccataagctgcagcttctgaaataaatgaacacaaacaaaattgaagtgagatt |
145 |
Q |
| |
|
||||||| |||| |||| | ||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7339572 |
actaatttgatggtttagttgcaaacaaacctcagtgttttggcttccataagctgcagcttctgaaataaatgaacagaaacaaaattgaagtgagatt |
7339671 |
T |
 |
| Q |
146 |
tcagctagacattcacacaaacagttagagtgc |
178 |
Q |
| |
|
||||||||||||| |||||||||||| |||||| |
|
|
| T |
7339672 |
tcagctagacattaacacaaacagttggagtgc |
7339704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 228 - 285
Target Start/End: Original strand, 7339739 - 7339796
Alignment:
| Q |
228 |
acctgcgatgacagattccaaggaagtggaatcagaggaacttgaatttgaaacaact |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
7339739 |
acctgcgatgacagattccaaggaagtggaatcagaggaactggaatttgatacaact |
7339796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 52; Significance: 1e-20; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 307 - 358
Target Start/End: Complemental strand, 54471978 - 54471927
Alignment:
| Q |
307 |
attgtgatggttgagatggggaagtgttagaaggtggagtcggagacggaga |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54471978 |
attgtgatggttgagatggggaagtgttagaaggtggagtcggagacggaga |
54471927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University