View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17878_high_14 (Length: 313)
Name: NF17878_high_14
Description: NF17878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17878_high_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 16 - 297
Target Start/End: Original strand, 26335970 - 26336258
Alignment:
| Q |
16 |
taggccattcattataccttgtcaaataggag---tgttggaaaaagggcaatatgtgatctaggatcctttatcaata----ctatggcattatcaact |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
26335970 |
taggccattcattataccttgtcaaataggaggagtattggaaaaagggcaatatgtgatctaggatcctttatatatatatactatggcattatcaact |
26336069 |
T |
 |
| Q |
109 |
tttcaacgggtccaaggattagaattacaaccagccataataaaggtggggttggcaaataggaagattgctcgaccatatcgggtggtagaaaacgtac |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
26336070 |
tttcaacgggtccaaggattagaattacaaccagccagaataaaggtggggttggcaaataggaagattgctcgaccatatctgatggtagaaaacgtac |
26336169 |
T |
 |
| Q |
209 |
ccataaaggtgaacaatttatccttcttgatggacttttttatattagaaatgaaggaatattgttttacaccaatactgttaggaaga |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
26336170 |
ccataaaggtgaacaatttatccttcttgatggaattttttatattagaaatgaaggaatattgttttataccaatactgttaggaaga |
26336258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University