View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17878_high_28 (Length: 252)
Name: NF17878_high_28
Description: NF17878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17878_high_28 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 12 - 231
Target Start/End: Complemental strand, 28310046 - 28309827
Alignment:
| Q |
12 |
atgaagatacttgcaaagaatgaaaagttcgagaaaatcgtgagtcccacaatttggtttttgcaacatgtgtttacaagggaggaggagaatattgcta |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28310046 |
atgaagatacttgcaaagaatgaaaagttcgagaaaatcgtgagtcccacaatttggtttttgcaacatgtgtttacaagggaggaggagaatattgcta |
28309947 |
T |
|
| Q |
112 |
gtgaaaatgctagcagtgttgttgtggccacaagagacaggctgagcttcagcatccacccagccgtagccactatgataggagccgaggaagacggagg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||| |||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
28309946 |
gtgaaaatgctagcagtgttgttgtggccataagagacaggctgagcttcaacatccacccggccgtagccactgtgataggagccgaggaagaaggagg |
28309847 |
T |
|
| Q |
212 |
aagggagccaccgtgaggag |
231 |
Q |
| |
|
|||||||||| |||||||| |
|
|
| T |
28309846 |
aagggagccatggtgaggag |
28309827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University