View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17878_low_12 (Length: 345)
Name: NF17878_low_12
Description: NF17878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17878_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 238; Significance: 1e-132; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 46 - 335
Target Start/End: Original strand, 42087883 - 42088170
Alignment:
| Q |
46 |
tgttaaaaatatgaaaatcatctcttcacaacattctcagctaaaaatgcatagtcataactacgcatttttccatttaaaattcctcaaatattgcttt |
145 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42087883 |
tgttgaaaatataaaaatcatctcttcacaacattctcagctaaaaatgcatagtcatagctacgcatttttccatttaaaattcctcaaatattgcttt |
42087982 |
T |
 |
| Q |
146 |
taagggtttttgttaacattctcagttttgttaatgacagtttctttcacgttttgaactatccgatccttctcttaatatataaatgtaatgtagtctc |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
42087983 |
taagggtttttgttaacattctcagttttgttaatgacagtttctttcacgttttgaactatcc--tctttctcttaatatataaatgtaatgtagtctc |
42088080 |
T |
 |
| Q |
246 |
taagtagactctagccctccaaacctgttttccctcctcaagttaactaaatttgcaaagacaaattnnnnnnntgctttcacacctttg |
335 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
42088081 |
taagtagactctagccctccaaacctgttttccctcctgaagttaactaaatttgcaaagacaaattaaaaaaatgctttcacacctttg |
42088170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 16 - 45
Target Start/End: Original strand, 42087840 - 42087869
Alignment:
| Q |
16 |
gttcaaagaacctataaaaatataagttaa |
45 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
42087840 |
gttcaaagaacctataaaaatataagttaa |
42087869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University