View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17878_low_4 (Length: 499)

Name: NF17878_low_4
Description: NF17878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17878_low_4
NF17878_low_4
[»] chr7 (2 HSPs)
chr7 (67-137)||(41104697-41104762)
chr7 (1-66)||(41104449-41104509)


Alignment Details
Target: chr7 (Bit Score: 47; Significance: 1e-17; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 67 - 137
Target Start/End: Original strand, 41104697 - 41104762
Alignment:
67 tttgttacgagtcgggaatccttcccttgcaattgaatagactaatcattatatttgaaccaaatagtatt 137  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||     |||||||||||||||||||    
41104697 tttgttacgattcgggaatccttcccttgcaattgaatagactaatc-----atttgaaccaaatagtatt 41104762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 41104449 - 41104509
Alignment:
1 tggcatacccataattcttctcaccgccatttcattcatataaactattaactgtccagtaaaata 66  Q
    |||||||||||||||||||||||||||     ||||||||||||||||||||| ||||||||||||    
41104449 tggcatacccataattcttctcaccgc-----cattcatataaactattaactatccagtaaaata 41104509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University