View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17879_low_5 (Length: 202)
Name: NF17879_low_5
Description: NF17879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17879_low_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 28 - 186
Target Start/End: Complemental strand, 4611759 - 4611605
Alignment:
| Q |
28 |
atatacttctttttaagagtttacattattgtcagaagcatagtaatcaaaactcagttatgatgttgtgcatctttgaattcatcacaagaacatacaa |
127 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4611759 |
atatatttctttttaagagtttacattattgtcagaagcata----tcaaaacttagttatgatgttgtgcatctttgaattcatcacaagaacatacaa |
4611664 |
T |
 |
| Q |
128 |
gcactgttagctcaaacccaactacaggcagtgtccttggatattcctttctccttcat |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4611663 |
gcactgttagctcaaacccaactacaggcagtgtccttggatattcctttctccttcat |
4611605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University