View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1787_high_24 (Length: 401)
Name: NF1787_high_24
Description: NF1787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1787_high_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 8e-77; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 8e-77
Query Start/End: Original strand, 185 - 385
Target Start/End: Original strand, 49766980 - 49767180
Alignment:
| Q |
185 |
cgagtttaccaagtttttcttgaagacaaaaagcacagatcccaccagggttgtttctgtatggatgatcaatgcattgcatgccatcaatggaatcatc |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49766980 |
cgagtttaccaagtttttcttgaagacaaaaagcacagatcccaccagggttgtttctatatggatgatcaatgcattgcatgccatcaatggaatcatc |
49767079 |
T |
 |
| Q |
285 |
ttcaacaccaatgttaactcttnnnnnnnnnnnnnnnnntcctttcataggttccatgtggaggatgtgaatcatccaaatctaaaataatagtatcttg |
384 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49767080 |
ttcaacaccaatgttaactcttccaccaccaccacctcctcctttcataggttccatgtggaggatgtgaatcatccaaatctaaaataatagtatcttg |
49767179 |
T |
 |
| Q |
385 |
t |
385 |
Q |
| |
|
| |
|
|
| T |
49767180 |
t |
49767180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 7 - 86
Target Start/End: Original strand, 49766799 - 49766881
Alignment:
| Q |
7 |
gagagagaagaagatgaagttacagcagttgtagctgatacagtgttgatg---gaagaagaagaaggacaatgacgagtagt |
86 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
49766799 |
gagagagaagaagatgaagttacagcagttgttgctgatacagtgttgatggaagaagaagaagaaggacaatgacgagtagt |
49766881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 187 - 233
Target Start/End: Complemental strand, 14137753 - 14137707
Alignment:
| Q |
187 |
agtttaccaagtttttcttgaagacaaaaagcacagatcccaccagg |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
14137753 |
agtttaccaagtttttcttgaagacaaaaagcacatataccaccagg |
14137707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University