View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1787_high_46 (Length: 291)
Name: NF1787_high_46
Description: NF1787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1787_high_46 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 121; Significance: 5e-62; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 130 - 281
Target Start/End: Complemental strand, 40410618 - 40410474
Alignment:
| Q |
130 |
aggggtgtttctatgtacgttgtttagcatacagtttcttgattaataaatatggcttgggttgtggcgtggctatcatgcatgccagctgaaggtaata |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40410618 |
aggggtgtttctatgtacgttgtttagcatacagtttcttgattaata----tggcttgggttgtggcgtggctatcatgcatgccagctgaaggtaa-- |
40410525 |
T |
 |
| Q |
230 |
aggaaatatctaagggtttggtgctcaatgtgacttggaaaatccacctatg |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40410524 |
-ggaaatatctaagggtttggtgctcaatgtgacttggaaaatccacctatg |
40410474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 1 - 120
Target Start/End: Complemental strand, 40410788 - 40410669
Alignment:
| Q |
1 |
attattcaacgggattctaaataaggtagtttggcttctcatggaagctattttggcaaaggatcctactctccttgactaataaatagttagagaaggg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40410788 |
attattcaacgggattctaaataaggtagtttggcttctcatggaagctattttggcaaaggatcctactctccttgactaataaatagttagagaaggg |
40410689 |
T |
 |
| Q |
101 |
taatgttcaagggctcagta |
120 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
40410688 |
taatgttcaagggctcagta |
40410669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University