View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1787_high_47 (Length: 290)

Name: NF1787_high_47
Description: NF1787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1787_high_47
NF1787_high_47
[»] chr1 (2 HSPs)
chr1 (142-243)||(34367860-34367963)
chr1 (1-34)||(34368070-34368103)


Alignment Details
Target: chr1 (Bit Score: 93; Significance: 3e-45; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 142 - 243
Target Start/End: Complemental strand, 34367963 - 34367860
Alignment:
142 cagccaatatgtgatgcttataatatat--tgataagaaatattaccactataatattacagaaaatacttcccacccaacataaacaatttagagcaaa 239  Q
    ||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34367963 cagccaatatgtgatgcttataatatatattgataagaaatattaccactataatattacagaaaatacttcccacccaacataaacaatttagagcaaa 34367864  T
240 caat 243  Q
    ||||    
34367863 caat 34367860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 34368103 - 34368070
Alignment:
1 ttaaattgtgtcaattaatatgaaacgtgaggag 34  Q
    ||||| ||||||||||||||||||||||||||||    
34368103 ttaaactgtgtcaattaatatgaaacgtgaggag 34368070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University