View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1787_high_56 (Length: 250)
Name: NF1787_high_56
Description: NF1787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1787_high_56 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-119; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 49522345 - 49522583
Alignment:
| Q |
1 |
ttgattccctatcattctcgttcgtccaacccttgctttatctaaatcaactgttgcatagagtcttgtcccaacaatcttcatcacaagtggttttgca |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49522345 |
ttgattccctatcattctggttcgtccaacccttgctttatctaaatcaactgttgcatagagtcttgtcccaacaatcttcatcacaagtggttttgca |
49522444 |
T |
 |
| Q |
101 |
tgttaagatttgaagaaactattttgcattaaaaacgaagaagtgtataaaagtggtagaaagtttggtgaaaatgtgtacctcaggccggcacaagata |
200 |
Q |
| |
|
||||||| |||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49522445 |
tgttaagttttgaagaaactattttgcatt-aaaacgaagaagtgcataaaagtggtagaaagtttggtgaaaatgtgtacctcaggccggcacaagata |
49522543 |
T |
 |
| Q |
201 |
caacccttgacttgggctagaaatctcttccccttctgtg |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
49522544 |
caacccttgacttgggctagaaatctcttccccttgtgtg |
49522583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 8 - 60
Target Start/End: Original strand, 49511390 - 49511442
Alignment:
| Q |
8 |
cctatcattctcgttcgtccaacccttgctttatctaaatcaactgttgcata |
60 |
Q |
| |
|
||||||||||| |||| |||||| |||||||| |||||||||||||||||||| |
|
|
| T |
49511390 |
cctatcattctagttcttccaactcttgctttgtctaaatcaactgttgcata |
49511442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University