View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1787_low_16 (Length: 448)
Name: NF1787_low_16
Description: NF1787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1787_low_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 103; Significance: 4e-51; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 103; E-Value: 4e-51
Query Start/End: Original strand, 205 - 319
Target Start/End: Complemental strand, 46455870 - 46455756
Alignment:
| Q |
205 |
aatgcacaggaggtggtggggattgaactggtggtggcggtgatcgtgttcttcttttgggtgcttcattatgaggatcatcctcaattggtggttctgc |
304 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46455870 |
aatgcacaggaggtggtgaggattgaactggtggcggcggtgatcgtgttcttcttttgggtgcttcattatgaggatcatcctcaattggtggttctgc |
46455771 |
T |
 |
| Q |
305 |
ttgaggtgtagaagg |
319 |
Q |
| |
|
|| |||||||||||| |
|
|
| T |
46455770 |
ttcaggtgtagaagg |
46455756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 388 - 433
Target Start/End: Complemental strand, 46455687 - 46455642
Alignment:
| Q |
388 |
ttggggtttgcgaaggtgtaggttgcggttgtggcttaggcactga |
433 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46455687 |
ttggggtttgcgaaggtgtaggttgcggttgtggcttaggcactga |
46455642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University