View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1787_low_34 (Length: 335)
Name: NF1787_low_34
Description: NF1787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1787_low_34 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-106; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-106
Query Start/End: Original strand, 15 - 242
Target Start/End: Complemental strand, 45646173 - 45645946
Alignment:
| Q |
15 |
aattggggcatgttcaatattcattttcctttggatgattgaaatttgtaagatccctaatgcgtgcttcttattttggtaatcaaattcaaatgtgctt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45646173 |
aattggggcatgttcaatattcattttcctttggatgattgaaatttgtaagatccctaatgcgtgcttcttattttggtaatcaaattcaaatgtgctt |
45646074 |
T |
|
| Q |
115 |
gttatttttgcaattatgtggagcaagcaatcacattgtagatcttgtttggataaacagtttaaataaacgtgtatggcataannnnnnnnatatattt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
45646073 |
gttatttttgcaattatgtggagcaagcaatcacattgtagatcttgtttggataaacagtttaaataaacgtgtatggcataattttttttatatattt |
45645974 |
T |
|
| Q |
215 |
tatgcataaattattttcataacgaaaa |
242 |
Q |
| |
|
|||||||||||||| |||||||| |||| |
|
|
| T |
45645973 |
tatgcataaattatcttcataacaaaaa |
45645946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 268 - 319
Target Start/End: Complemental strand, 45645945 - 45645894
Alignment:
| Q |
268 |
tatggtcaaattgttttgggaggctttcaaaaataaactaaaaatataactt |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45645945 |
tatggtcaaattgttttgggaggctttcaaaaataaactaaaaatataactt |
45645894 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University