View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1787_low_48 (Length: 281)
Name: NF1787_low_48
Description: NF1787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1787_low_48 |
 |  |
|
| [»] chr1 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 18 - 281
Target Start/End: Complemental strand, 2598564 - 2598283
Alignment:
| Q |
18 |
ctcagtgactctaatgttcagcacaattgaaatcatgaaagtaatgaagaaccttttgacgcggaagcattggctt------------------tgcagc |
99 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
2598564 |
ctcagtgactttaatgttcagcacaattggaatcatgaaagtaatgaagaaccttttgacgcggaagcattggcttcacgctagggattcactttgcagc |
2598465 |
T |
 |
| Q |
100 |
tgaacaggttttgtgcaaacgtaaatattaaaagtagatcagtataggcattcccgtagaaagtagaaacagcaacaaattagcgcattttttaggtaag |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2598464 |
tgaacaggttttgtgcaaacgtaaatattaaaagtagatcagtataggcattgccgtagaaagtagaaacagcaacaaattagcgcattttttaggtaag |
2598365 |
T |
 |
| Q |
200 |
catgctattttaaatggggaaggtgtttggattgaagatattccatatttcttgatatatcctttagtacatgacctagccc |
281 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| |||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
2598364 |
catgctattttaaatggggaagatgtttggattgaagatatttcatatttcttgatacatcctttactacatgacctagccc |
2598283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 212 - 281
Target Start/End: Complemental strand, 2583046 - 2582977
Alignment:
| Q |
212 |
aatggggaaggtgtttggattgaagatattccatatttcttgatatatcctttagtacatgacctagccc |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||| ||||||| |||||||||||||||| |
|
|
| T |
2583046 |
aatggggaaggtgtttggattgaagatattccatatttctttatacatcctttggtacatgacctagccc |
2582977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 163 - 227
Target Start/End: Complemental strand, 2583836 - 2583772
Alignment:
| Q |
163 |
tagaaacagcaacaaattagcgcattttttaggtaagcatgctattttaaatggggaaggtgttt |
227 |
Q |
| |
|
|||||||| |||| ||||||| |||||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
2583836 |
tagaaacaacaaccaattagcccattttttagctaagtatgctattttaaatggggaaggtgttt |
2583772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University