View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1787_low_61 (Length: 235)
Name: NF1787_low_61
Description: NF1787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1787_low_61 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 2412836 - 2412615
Alignment:
| Q |
1 |
tacaagatcagacatctcagatcacacattcacaaaataaattttaaacatacggtcgaaatcactaactgtgtgacacagtttttggaggcaacctatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2412836 |
tacaagatcagacatctcagatcacacattcacaaaataaattttaaacatacggtcgaaatcactaactgtgtgacacagtttttggaggcaacctatt |
2412737 |
T |
|
| Q |
101 |
tcttaccattagagagaattgatgtgattctactagtgctgttctaataggcattatttatcttcaggatgaactattgtggggagctgcatggcttttt |
200 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2412736 |
tcttactattagagagaattgatgtgattctactagtgctgttctaataggcattatttatcttcaggatgaactattgtggggagctgcatggcttttt |
2412637 |
T |
|
| Q |
201 |
agagcaacaaatgctgctaaat |
222 |
Q |
| |
|
|||||||||||||||| ||||| |
|
|
| T |
2412636 |
agagcaacaaatgctgttaaat |
2412615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University