View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1787_low_63 (Length: 226)
Name: NF1787_low_63
Description: NF1787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1787_low_63 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 19 - 216
Target Start/End: Original strand, 18004114 - 18004311
Alignment:
| Q |
19 |
acaacagaagcacgttgttttgttccgccaaatgtgagtcctccactgcattgtggtgctcctccccccatgtttggagagtttccgagaaacatgtgct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18004114 |
acaacagaagcacgttgttttgttccgccaaatgtgagtcctccactgcattgtggtgctcctccccccatgtttggagagtttccgagaaacatgtgct |
18004213 |
T |
 |
| Q |
119 |
ctggctgcctaaaactgaaactgttgccggaaaaacatgtccgatcagaacaacttgtgatggaagatatgttatctctggtttttgaggaatgatga |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18004214 |
ctggctgcctaaaactgaaactgttgccggaaaaacatgtccgatcggaacaacttgtgatggaagatatgttatctctggtttttgaggaatgatga |
18004311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University