View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1787_low_64 (Length: 224)
Name: NF1787_low_64
Description: NF1787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1787_low_64 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 19 - 211
Target Start/End: Complemental strand, 3808387 - 3808195
Alignment:
| Q |
19 |
agagctatttataaactttaaccaaaattttccacacatctatctctataaaatattggcgatttacatacaaagtatgtggggtgtgacatatgcaagt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3808387 |
agagctatttataaactttaaccaaaattttccacacatctatctctataaaatattggcgatttacatacaaagtatgtggggtgtgacatatgcaagt |
3808288 |
T |
|
| Q |
119 |
cactcactacttagttttaaccaaagaaaaggggaacaaatgaaattaaccaagttcaaaacgaccaggaataaaacttattaagttgattgt |
211 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
3808287 |
cactcactacttagttctaaccaaagaaaaggggaacaaatgaaattaaccaagttcaaaacgatcaggaataaaacttattaagttgattgt |
3808195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 69 - 170
Target Start/End: Complemental strand, 3776593 - 3776491
Alignment:
| Q |
69 |
aaatattggcgatttacatacaaagtatgtggggtgtgacatatgcaagtcactcactacttagttttaacc--aaagaaaaggggaacaaatgaaatta |
166 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||| |||| |||||||| ||| ||||| |||||||| ||||||| |
|
|
| T |
3776593 |
aaatattggcgatttacatacaa-gtatgtggggtgtgacatttgcaagtcactcactccttaattttaaccaaaaaaaaaagaggaacaaaagaaatta |
3776495 |
T |
|
| Q |
167 |
acca |
170 |
Q |
| |
|
|||| |
|
|
| T |
3776494 |
acca |
3776491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University