View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1787_low_65 (Length: 223)
Name: NF1787_low_65
Description: NF1787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1787_low_65 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 20 - 132
Target Start/End: Original strand, 13739760 - 13739872
Alignment:
| Q |
20 |
acatgtgtatgacaatcattgtagggtctatcatttgggtgagtgagtggtggtcgatatcttatctttaattggtatagtctggtgacaataaatgatt |
119 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
13739760 |
acatgtgtatgacaatcattgtaggatctatcatttgggtgagtgagtggtggtcgatatcttatctttaattggtatagtccggtgacaataaatgatt |
13739859 |
T |
|
| Q |
120 |
acaaaggaagagt |
132 |
Q |
| |
|
||||||||||||| |
|
|
| T |
13739860 |
acaaaggaagagt |
13739872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 20 - 132
Target Start/End: Original strand, 13745260 - 13745372
Alignment:
| Q |
20 |
acatgtgtatgacaatcattgtagggtctatcatttgggtgagtgagtggtggtcgatatcttatctttaattggtatagtctggtgacaataaatgatt |
119 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
13745260 |
acatgtgtatgacaatcattgtaggatctatcatttgggtgagtgagtggtggtcgatatcttatctttaattggtatagtccggtgacaataaatgatt |
13745359 |
T |
|
| Q |
120 |
acaaaggaagagt |
132 |
Q |
| |
|
||||||||||||| |
|
|
| T |
13745360 |
acaaaggaagagt |
13745372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University