View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17880_high_5 (Length: 319)
Name: NF17880_high_5
Description: NF17880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17880_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 95; Significance: 2e-46; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 78 - 192
Target Start/End: Original strand, 10311885 - 10311999
Alignment:
| Q |
78 |
atacctggtcatggtacttgtcaccaatgatgacaaacatggacatatgccttgttttgacaccattttcaatgagagttctgattcgctcatccacctt |
177 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||| || ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
10311885 |
atacctggtcatagtacttgtcaccaatgatgacaaacatggacctatgccttgttttaacgccattctcaatgagagttctgattcgctcatccacctt |
10311984 |
T |
 |
| Q |
178 |
cttcctcatatctct |
192 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
10311985 |
cttcctcatatctct |
10311999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 77 - 186
Target Start/End: Original strand, 38436224 - 38436333
Alignment:
| Q |
77 |
gatacctggtcatggtacttgtcaccaatgatgacaaacatggacatatgccttgttttgacaccattttcaatgagagttctgattcgctcatccacct |
176 |
Q |
| |
|
|||||||| ||| || | |||||||| || |||||||||||||| |||||||| |||||| |||||||| || ||||||||||| || |||||||||| |
|
|
| T |
38436224 |
gatacctgatcacgggatttgtcaccgataatgacaaacatggatcgatgccttgatttgacgccattttcgataagagttctgatacgttcatccacct |
38436323 |
T |
 |
| Q |
177 |
tcttcctcat |
186 |
Q |
| |
|
|||||||||| |
|
|
| T |
38436324 |
tcttcctcat |
38436333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University