View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17880_high_7 (Length: 247)
Name: NF17880_high_7
Description: NF17880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17880_high_7 |
 |  |
|
| [»] scaffold0041 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 28 - 162
Target Start/End: Complemental strand, 29041277 - 29041144
Alignment:
| Q |
28 |
ggtgctgaaaccgccgctgctgaagtcagagccatgggagatgggcgcagctttggatggtgtagctgccggcaaggagaactctgcctgccagtcgaaa |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||| |||||||||||||||||||| || |||||||||||||| |
|
|
| T |
29041277 |
ggtgctgaaaccgccgctgctgaagtcagagccatgggagatggt-gcaactttggatggtatagctgccggcaaggagaacactacctgccagtcgaaa |
29041179 |
T |
 |
| Q |
128 |
ggcatagcataaattcggtaggaacaaacaggtcg |
162 |
Q |
| |
|
|||||| ||||||| |||||| ||||| ||||||| |
|
|
| T |
29041178 |
ggcataacataaatccggtagaaacaatcaggtcg |
29041144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 25 - 136
Target Start/End: Original strand, 28975904 - 28976014
Alignment:
| Q |
25 |
tgtggtgctgaaaccgccgctgctgaagtcagagccatgggagatgggcgcagctttggatggtgtagctgccggcaaggagaactctgcctgccagtcg |
124 |
Q |
| |
|
|||||||||| |||||||| || || | ||| |||||||||||||| ||||||||||| | || |||||||||||| | |||||||||||| ||||| |
|
|
| T |
28975904 |
tgtggtgctggaaccgccgttgtggacggcagtgccatgggagatggt-gcagctttggaggatgcagctgccggcaataacaactctgcctgctagtcg |
28976002 |
T |
 |
| Q |
125 |
aaaggcatagca |
136 |
Q |
| |
|
|| ||||||||| |
|
|
| T |
28976003 |
aacggcatagca |
28976014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 28 - 136
Target Start/End: Original strand, 38501778 - 38501885
Alignment:
| Q |
28 |
ggtgctgaaaccgccgctgctgaagtcagagccatgggagatgggcgcagctttggatggtgtagctgccggcaaggagaactctgcctgccagtcgaaa |
127 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
38501778 |
ggtgctgaaatcgccgctgctgaagtcagagccatgggagatgg-cgctgctttggatggtgtagctgccggcaaagagagctctgcctgccagtcgaaa |
38501876 |
T |
 |
| Q |
128 |
ggcatagca |
136 |
Q |
| |
|
||||||||| |
|
|
| T |
38501877 |
ggcatagca |
38501885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 25 - 117
Target Start/End: Complemental strand, 9282804 - 9282713
Alignment:
| Q |
25 |
tgtggtgctgaaaccgccgctgctgaagtcagagccatgggagatgggcgcagctttggatggtgtagctgccggcaaggagaactctgcctg |
117 |
Q |
| |
|
|||||||||| ||||| |||| |||| ||| |||||||||||||| | || ||||||| |||||||||| |||||| | ||||||||||| |
|
|
| T |
9282804 |
tgtggtgctgggaccgcagctgtggaagacagtgccatgggagatgg-cacaactttggagggtgtagctgtcggcaataacaactctgcctg |
9282713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 28 - 162
Target Start/End: Complemental strand, 20950466 - 20950333
Alignment:
| Q |
28 |
ggtgctgaaaccgccgctgctgaagtcagagccatgggagatgggcgcagctttggatggtgtagctgccggcaaggagaactctgcctgccagtcgaaa |
127 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||| | |||||||||||||||||||||||| |||||||||| |||||||||||| |||||| |
|
|
| T |
20950466 |
ggtgctgaaaccgccgctgctggagtcaaagccatgggagattg-cgcagctttggatggtgtagctgctggcaaggagagctctgcctgccattcgaaa |
20950368 |
T |
 |
| Q |
128 |
ggcatagcataaattcggtaggaacaaacaggtcg |
162 |
Q |
| |
|
||||||||| |||| ||||| ||||| ||||||| |
|
|
| T |
20950367 |
ggcatagcagaaatccggtataaacaatcaggtcg |
20950333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0041 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: scaffold0041
Description:
Target: scaffold0041; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 44 - 141
Target Start/End: Original strand, 5318 - 5414
Alignment:
| Q |
44 |
ctgctgaagtcagagccatgggagatgggcgcagctttggatggtgtagctgccggcaaggagaactctgcctgccagtcgaaaggcatagcataaat |
141 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||| |||| |||||| ||||||||||||||||||||| |||| |
|
|
| T |
5318 |
ctgctgaagtcagagccatgggagatgg-cgcaactttggatggtgtagctgccggcaaagagagctctgcttgccagtcgaaaggcatagcagaaat |
5414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 73 - 126
Target Start/End: Original strand, 33066792 - 33066845
Alignment:
| Q |
73 |
cgcagctttggatggtgtagctgccggcaaggagaactctgcctgccagtcgaa |
126 |
Q |
| |
|
|||||||||||| |||| ||||| |||||| | |||||||||||||||||||| |
|
|
| T |
33066792 |
cgcagctttggagggtgcagctgtcggcaataacaactctgcctgccagtcgaa |
33066845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University