View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17880_high_8 (Length: 247)
Name: NF17880_high_8
Description: NF17880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17880_high_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 7926085 - 7925853
Alignment:
| Q |
1 |
ttgttgcaggctaagagagataacacgcagccctgcttcccatgcaatggatctggagctcgtaagtatcattttttctctcttcaatttcatcatcaca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7926085 |
ttgttgcaggctaagagagataacacgcagccctgcttcccatgcaatggatctggagctcgtaagtatcattttttttctcttcaatttcatcatcaca |
7925986 |
T |
|
| Q |
101 |
ctttatacttttatgaatggagcattatggaggtagttcacaagttattgttaatttggagtaatttttacttttagtacataactattgttgctgctgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7925985 |
ctttatacttttatgaatggagcattatggaggtagttcacaagttattgttaatttggagtaatttttacttttagtacataactattgttgctgctgt |
7925886 |
T |
|
| Q |
201 |
agtgtaatgtgcaaggccaacgtatagattagt |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
7925885 |
agtgtaatgtgcaaggccaacgtatagattagt |
7925853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University