View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17880_low_2 (Length: 389)
Name: NF17880_low_2
Description: NF17880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17880_low_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 360; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 360; E-Value: 0
Query Start/End: Original strand, 11 - 374
Target Start/End: Original strand, 52592446 - 52592809
Alignment:
| Q |
11 |
caaaggactcgaggtgaacatatccatataggaccctgaagagaatgcttggttgggatacattctaagttacaagacaagatcagcacttgttgggaac |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52592446 |
caaaggactcgaggtgaacatatccatataggaccctgaagagaatgcttggttgggatacattctaagttacaagacaagatcagcacttgttgggaac |
52592545 |
T |
 |
| Q |
111 |
aagaacctcacttctggtctcttcacaacaatgaaatcagcttgatatctttttcaatgggaaacaattgtcttggcgatgattatgcaatatttcatct |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52592546 |
aagaacctcacttctggtctcttcacaacaatgaaatcagcttgatatctttttcaatgggaaacaattgtcttggcgatgattatgcaatatttcatct |
52592645 |
T |
 |
| Q |
211 |
tctattctgataacaatgaatttcaatcaaaagcacattatgattattatggaatacaaaatacggtttttggaggtggggaagattacctaagttatta |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
52592646 |
tctattctgataacaatgaatttcaatcaaaagcacattatgattattatggaatacaaaatacggttttcggaggtggggaagattacctaagttatta |
52592745 |
T |
 |
| Q |
311 |
aacaagaccaaaaacataaagatggcattagtttatagactatattgggctattagcatatatt |
374 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52592746 |
aacaagaccaaaaacataaagatggcattagtttatagactatattgggctattagcatatatt |
52592809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University