View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17880_low_9 (Length: 245)
Name: NF17880_low_9
Description: NF17880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17880_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 16 - 231
Target Start/End: Original strand, 15234522 - 15234736
Alignment:
| Q |
16 |
agatggaggagcaaatggggattgttttggtctttctattgaaccgtcgctaaagatacgaaggatatttcccatttcggtaactatttctttagtgatg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15234522 |
agatggaggagcaaatggggattgttttggtctttctattgaaccgtcgctaaagatacgaaggatatttcccatttcggtaactatttctttagtgatg |
15234621 |
T |
 |
| Q |
116 |
gtttttggtgtcgtgggtgttgtggaagccatttcaattgaggatgtgaagagtgtttgaaaaggagtttcaatgtaaaatatgagggttaatttggcgt |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
15234622 |
gtttttggtgtcgtgggtgttgtggaagccatttcaattgaggatgtgaagagtgtttg-aaaggagtttcaatgtaaaatatgagggttaatttggtgt |
15234720 |
T |
 |
| Q |
216 |
tttgattggtgatgat |
231 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
15234721 |
tttgattggtgatgat |
15234736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 16 - 170
Target Start/End: Complemental strand, 17473001 - 17472847
Alignment:
| Q |
16 |
agatggaggagcaaatggggattgttttggtctttctattgaaccgtcgctaaagatacgaaggatatttcccatttcggtaactatttctttagtgatg |
115 |
Q |
| |
|
|||||||||| | ||||| |||||| ||||||||| | ||||||||||||||||||||||| || |||| | |||||||||||||||||||| || | |
|
|
| T |
17473001 |
agatggaggaaccaatggtgattgtgatggtctttccactgaaccgtcgctaaagatacgaatgaatgttccaaattcggtaactatttctttagcgacg |
17472902 |
T |
 |
| Q |
116 |
gtttttggtgtcgtgggtgttgtggaagccatttcaattgaggatgtgaagagtg |
170 |
Q |
| |
|
|||| |||||| || ||||| ||||||||||||||| |||||||| ||||||| |
|
|
| T |
17472901 |
gtttctggtgtggtttgtgttttggaagccatttcaactgaggatgaaaagagtg |
17472847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University