View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17882_high_30 (Length: 244)
Name: NF17882_high_30
Description: NF17882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17882_high_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 92; Significance: 8e-45; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 1 - 152
Target Start/End: Original strand, 34158285 - 34158435
Alignment:
| Q |
1 |
accataagggattcaaagtggttttccggtaacatg-------agacaaaccatattggattgataatgattttatgtgcaaaaggcggaccgaaaactc |
93 |
Q |
| |
|
|||||||| |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
34158285 |
accataagcgattcaaagtggttttccggtaccatgagtcatgagacaaaccatattggattgataatgattttatgtgcaaaaggtggaccgaaaactc |
34158384 |
T |
 |
| Q |
94 |
aaattgtgttttctagtatggtattgctaacttattactctaatgttggaaataattca |
152 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34158385 |
aaattgtgttttc--------tattgctaacttattactctaatgttggaaataattca |
34158435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 169 - 226
Target Start/End: Original strand, 34158787 - 34158844
Alignment:
| Q |
169 |
taaattttatatatgaagccaaaaataggtagttcaagtaaaatgcaggggtgacaat |
226 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
34158787 |
taaattttatatatgaggccaaaaataggtagttcaagtaaaatgaaggggtgacaat |
34158844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University