View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17882_low_12 (Length: 428)

Name: NF17882_low_12
Description: NF17882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17882_low_12
NF17882_low_12
[»] chr3 (1 HSPs)
chr3 (61-118)||(37499144-37499201)


Alignment Details
Target: chr3 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 61 - 118
Target Start/End: Complemental strand, 37499201 - 37499144
Alignment:
61 taaagtaacattattaccatggtgcttgtgttaggttttaatggaacacgacttgacc 118  Q
    ||||| ||| ||||||||||||||  ||||||||||||||||||||||||||||||||    
37499201 taaagaaacgttattaccatggtgtctgtgttaggttttaatggaacacgacttgacc 37499144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University