View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17882_low_23 (Length: 280)
Name: NF17882_low_23
Description: NF17882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17882_low_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 12 - 263
Target Start/End: Original strand, 6577891 - 6578139
Alignment:
| Q |
12 |
aattgatgagggtgggttactgcagatgtgataaagagaaatgcagagaaaatcaaagaaccgctaagaaatcaaggaacccannnnnnnaattagagaa |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
6577891 |
aattgatgagggtgggttactgcagatgtgataaagagaaatgcagagaaaatcaaagaaccgctaagaaatcaaggaacccatttttttaattagagaa |
6577990 |
T |
 |
| Q |
112 |
ataactcatgtttaccatgtagaaaaagcaagtatttaacttgttgagctttgatagtgtgttttagcagaattctttttgatgattattaaaataggtt |
211 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6577991 |
ataactcatgtttaccatatagaaagagcaagtatttaacttgttgagctttgatagtgtgttttagcagaattctttttgatgattattaaaataggtt |
6578090 |
T |
 |
| Q |
212 |
tccaattcgatgcacagtgaagaagaagaaggtgacttttcatgtacaaagt |
263 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
6578091 |
tccaattcgatgcacagt---gaagaagaaggtgacttttcatgtacaaagt |
6578139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University