View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17882_low_25 (Length: 272)
Name: NF17882_low_25
Description: NF17882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17882_low_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 10 - 256
Target Start/End: Original strand, 7499226 - 7499472
Alignment:
| Q |
10 |
catcaccacttagagcttcatccactttgactggtacaatcattgacaaaagtcccactagagaagttacattccttaatgttgatcttgtctttctaga |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7499226 |
catcaccacttagagcttcatccactttgactggtgcaatcattgacaaaagtcccactagagaagttacattccttaatgttgatcttgtctttctaga |
7499325 |
T |
 |
| Q |
110 |
atcaccttgttgtcaataatgaggtcttctagatgtgagcttttgtttttgaatcttctatctgttcaggggattggtcaccatctagggcatcttttgg |
209 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7499326 |
atcaccttgttgccaataatgaggtcttctagatgtgagcttttgtttttgaatcttctatctgttcaggggattggtcaccatctagggcatcttttgg |
7499425 |
T |
 |
| Q |
210 |
tacaccagaaggttcgtttctttccgaagttacttctcgttcctttt |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
7499426 |
tacaccagaaggttcgtttctttccgaagttacttctcattcctttt |
7499472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University