View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17882_low_26 (Length: 271)
Name: NF17882_low_26
Description: NF17882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17882_low_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 1 - 268
Target Start/End: Original strand, 28667038 - 28667290
Alignment:
| Q |
1 |
tgcaatatccaacacactagactctcatctctcttgacaaaatttgcactaaatgtacgacttgctgttatctaattttatctaaactcaagtacaattg |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||| |||| |||||||||||||||| |
|
|
| T |
28667038 |
tgcaatatccaacacactagactctaatctctcttgacaaaatttgcactaaatgtacgaattgcagtta--------------aactcaagtacaattg |
28667123 |
T |
 |
| Q |
101 |
gtttctaattttattatccttttattacaatttgatcatacaaaattctttgatttaattttaaggatgctagcataaaagacaaacaaatgttcgatct |
200 |
Q |
| |
|
| |||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
28667124 |
ttatctaattttattatccatttattacaatttgatcatacaaaattctatgatttaattttaaggatgctagc-taaaagacaaacaaatgttcgatct |
28667222 |
T |
 |
| Q |
201 |
tagctatgagaggtgtatgcatttagtgtacgaccatgaactcatgcctcgaacaaaattactcatat |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
28667223 |
tagctatgagaggtgtatgcatttagtgtacgaccatgaactcgtgcctcgaacaaaattactcatat |
28667290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University