View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17882_low_29 (Length: 251)
Name: NF17882_low_29
Description: NF17882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17882_low_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 1 - 146
Target Start/End: Complemental strand, 34158240 - 34158099
Alignment:
| Q |
1 |
tccaatctataactcagaaaactcatataaactaatatgctttagacctaatttatagaaaactccaacaaatgatcttgatcaaatatggtttcgcaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34158240 |
tccaatctataactcagaaaactcatataaattaatatgctttagacctaatttacagaaaacgccaacaaatgatctcgatcaaatatggtttcgcaaa |
34158141 |
T |
 |
| Q |
101 |
acacaaacatatgattttaattagttcgtaaaagttaccaaacttg |
146 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
34158140 |
acacaaacatatgatt----ttagttagtaaaagttaccaaacttg |
34158099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University