View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17882_low_35 (Length: 237)
Name: NF17882_low_35
Description: NF17882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17882_low_35 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 35869181 - 35869398
Alignment:
| Q |
1 |
gtggggaaagaaggtgcataacacttttagcatcactttttcctaaaccatcaccaactacaacaatttgcctgttgttaaactttgttcctttgtcaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
35869181 |
gtggggaaagaaggtgcataacacttttaggatcactttttcctaaaccatcaccaactacaacaatttgc---ttgttaaactttgttcctttgtcaaa |
35869277 |
T |
|
| Q |
101 |
tgagctttgcacaagttgcaaggacatggattcttggccactttccattgaaaggttccttgaatttgaacttcttttggatccttgtgactgcgcctct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35869278 |
tgagctttgcacaagttgcaaggacatggattcttggccaatttccattgaaaggttccttgaatttgaacttcttttggatccttgtgactgcgcctct |
35869377 |
T |
|
| Q |
201 |
tgaaaactttcatgaccttgg |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
35869378 |
tgaaaactttcatgaccttgg |
35869398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 24443382 - 24443599
Alignment:
| Q |
1 |
gtggggaaagaaggtgcataacacttttagcatcactttttcctaaaccatcaccaactacaacaatttgcctgttgttaaactttgttcctttgtcaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24443382 |
gtggggaaagaaggtgcataacacttttaggatcactttttcctaaaccatcaccaactacaacaatttgc---ttgttaaactttgttcctttgtcaaa |
24443478 |
T |
|
| Q |
101 |
tgagctttgcacaagttgcaaggacatggattcttggccactttccattgaaaggttccttgaatttgaacttcttttggatccttgtgactgcgcctct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24443479 |
tgagctttgcacaagttgcaaggacatggattcttggccaatttccattgaaaggttccttgaatttgaacttcttttggatccttgtgactgcgcctct |
24443578 |
T |
|
| Q |
201 |
tgaaaactttcatgaccttgg |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
24443579 |
tgaaaactttcatgaccttgg |
24443599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University