View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17882_low_37 (Length: 211)
Name: NF17882_low_37
Description: NF17882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17882_low_37 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 19 - 199
Target Start/End: Complemental strand, 36722562 - 36722388
Alignment:
| Q |
19 |
gttggtgctgctggtgctcgtgctggcgaaaaatttcatagtggctgtgattcatctacatctgctgttgatgatgacgaaaattttgttattctcagtt |
118 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
36722562 |
gttggtgctgctgctgctcgtgctggcaaaaaatttcatagtggctgtgattcatctacatctgctgttgatgatgacgaaaattgtgttattctcagtt |
36722463 |
T |
 |
| Q |
119 |
cttttactgcttcagtgaagaagcctacggtccaggctcatgctccgacccaggctcatgttcatgctcccgcacaggttc |
199 |
Q |
| |
|
||| |||||||||||||| |||||||| ||||||| |||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
36722462 |
cttctactgcttcagtgaggaagcctatggtccag------gctccggcccaggctcatgttcatgctcccgctcaggttc |
36722388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 19 - 187
Target Start/End: Complemental strand, 36709690 - 36709522
Alignment:
| Q |
19 |
gttggtgctgctggtgctcgtgctggcgaaaaatttcatagtggctgtgattcatctacatctgctgttgatgatgacgaaaattttgttattctcagtt |
118 |
Q |
| |
|
||||||| |||||||||| ||||||| ||| | ||||||||||| |||||||||||| |||||| |||||||||||||||| ||| |||||||||||||| |
|
|
| T |
36709690 |
gttggtggtgctggtgctggtgctggtgaagattttcatagtggttgtgattcatcttcatctgttgttgatgatgacgaagattgtgttattctcagtt |
36709591 |
T |
 |
| Q |
119 |
cttttactgcttcagtgaagaagcctacggtccaggctcatgctccgacccaggctcatgttcatgctc |
187 |
Q |
| |
|
||| | | |||||||||| ||||||| |||||||||| ||||||| | |||| ||||| |||||||||| |
|
|
| T |
36709590 |
cttctgccgcttcagtgaggaagcctccggtccaggcccatgctctggcccaagctcaggttcatgctc |
36709522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University