View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17882_low_37 (Length: 211)

Name: NF17882_low_37
Description: NF17882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17882_low_37
NF17882_low_37
[»] chr5 (2 HSPs)
chr5 (19-199)||(36722388-36722562)
chr5 (19-187)||(36709522-36709690)


Alignment Details
Target: chr5 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 19 - 199
Target Start/End: Complemental strand, 36722562 - 36722388
Alignment:
19 gttggtgctgctggtgctcgtgctggcgaaaaatttcatagtggctgtgattcatctacatctgctgttgatgatgacgaaaattttgttattctcagtt 118  Q
    ||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
36722562 gttggtgctgctgctgctcgtgctggcaaaaaatttcatagtggctgtgattcatctacatctgctgttgatgatgacgaaaattgtgttattctcagtt 36722463  T
119 cttttactgcttcagtgaagaagcctacggtccaggctcatgctccgacccaggctcatgttcatgctcccgcacaggttc 199  Q
    ||| |||||||||||||| |||||||| |||||||      |||||| ||||||||||||||||||||||||| |||||||    
36722462 cttctactgcttcagtgaggaagcctatggtccag------gctccggcccaggctcatgttcatgctcccgctcaggttc 36722388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 19 - 187
Target Start/End: Complemental strand, 36709690 - 36709522
Alignment:
19 gttggtgctgctggtgctcgtgctggcgaaaaatttcatagtggctgtgattcatctacatctgctgttgatgatgacgaaaattttgttattctcagtt 118  Q
    ||||||| |||||||||| ||||||| ||| | ||||||||||| |||||||||||| |||||| |||||||||||||||| ||| ||||||||||||||    
36709690 gttggtggtgctggtgctggtgctggtgaagattttcatagtggttgtgattcatcttcatctgttgttgatgatgacgaagattgtgttattctcagtt 36709591  T
119 cttttactgcttcagtgaagaagcctacggtccaggctcatgctccgacccaggctcatgttcatgctc 187  Q
    ||| | | |||||||||| ||||||| |||||||||| ||||||| | |||| ||||| ||||||||||    
36709590 cttctgccgcttcagtgaggaagcctccggtccaggcccatgctctggcccaagctcaggttcatgctc 36709522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University