View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17882_low_38 (Length: 204)
Name: NF17882_low_38
Description: NF17882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17882_low_38 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 19 - 188
Target Start/End: Original strand, 37315172 - 37315341
Alignment:
| Q |
19 |
ggtggaagccaaccaatactactataaatatctttttgaaaaagattcgaactataataagcaatatcaagaagaaaccaagtggaagttgttccaagca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37315172 |
ggtggaagccaaccaatactactataaatatctttttgaaaaagattcgaactataataagcaatatcaagaagaaaccaagtggaagttgttccaagca |
37315271 |
T |
 |
| Q |
119 |
gatgaagaccgtgtcttctaagaaactccttactaaacaaaccaaaactgttcttgtcttgcacgcctat |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37315272 |
gatgaagaccgtgtcttctaagaaactccttactaaacaaaccaaaactgttcttgtcttgcacgcctat |
37315341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 46 - 131
Target Start/End: Original strand, 30620144 - 30620229
Alignment:
| Q |
46 |
atatctttttgaaaaagattcgaactataataagcaatatcaagaagaaaccaagtggaagttgttccaagcagatgaagaccgtg |
131 |
Q |
| |
|
||||| ||||| ||||||||| ||| ||| | ||||||||||| | |||||| ||||| | ||||||||||||||| | |||||| |
|
|
| T |
30620144 |
atatccttttggaaaagattctgactgtaaaatgcaatatcaagcaaaaaccatgtggatgctgttccaagcagatgcaaaccgtg |
30620229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University