View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17883_high_10 (Length: 422)
Name: NF17883_high_10
Description: NF17883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17883_high_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 377; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 377; E-Value: 0
Query Start/End: Original strand, 11 - 406
Target Start/End: Original strand, 52830371 - 52830767
Alignment:
| Q |
11 |
gcagagatgatatgcacatatggtcatg-cttgcgatataaagcaaaagctgagtgtgccctagtatggtaatacatatctcttttccaggcttcagctg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52830371 |
gcagagatgatatgcacatatggtcatgtcttgcgatataaagcaaaagctgagtgtgccctagtatggtaatacatatctcttttccaggcttcagctg |
52830470 |
T |
 |
| Q |
110 |
caacaaaaggattttttcagcctaatttaaagcaatgtttcaggcttgccaaacatagcctgacacagaacaaccctactcgtctaacactgcatggggt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52830471 |
caacaaaaggattttttcagcctaatttaaagcaatgtttcaggcttgccaaacatagcctgacacagaacaaccctactcgtctaacactgcatggggt |
52830570 |
T |
 |
| Q |
210 |
gagtttacccacccgacaatgggatagggtggatggtgcaattttattgtagggatatcgtgagtttggggtaaattcacccagcacaataccacaccac |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52830571 |
gagtttacccacccgacaatgggatagggtggatggggcaattttattgtagggatatcgtgagtttggggtaaattcacccagcacaataccacaccac |
52830670 |
T |
 |
| Q |
310 |
tcatttaaataagagtcacgagtctcaatattaagtaaagtaaagtaattgttcattcgtattaagtaatatctattcacagaacagtatgagtcat |
406 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
52830671 |
tcatttaaataagagtcacgagtctcaatattaagtaaagtaaagtaattgttcattcgtattaagtaatatctattcacagaacaatatgactcat |
52830767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University