View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17883_high_18 (Length: 339)
Name: NF17883_high_18
Description: NF17883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17883_high_18 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 1 - 319
Target Start/End: Original strand, 18245061 - 18245379
Alignment:
| Q |
1 |
taaatcaccataaatacacataaagaaaaacatcatcactatcccaaaaaacatactccaaacaaacatagatataatccgacatgggaaattgcttgtt |
100 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||||||||||| |||||||||||||||| |||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
18245061 |
taaatcaccataaatacacacaaagaacaacatcatcactatcacaaaaaacatactccacacaaacattgatataatccaacatgggaaattgcttgtt |
18245160 |
T |
 |
| Q |
101 |
gggtgccaactcagatccagacacattgatcaaagtcataacatttgatggtaacatcatggaattctatcctccaattacagtcaatttcatcacaaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18245161 |
gggtgccaactcagatccagacacattgatcaaagtcataacatttgatggtaacatcatggaattctatcctccaattacagtcaatttcatcacaaat |
18245260 |
T |
 |
| Q |
201 |
gaattccaaggccatgccatattcccaaccaatgatcaatcttccaaaccactttgccaatttgatgagttggtggcaggacagtcatactatttactgc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
18245261 |
gaattccaaggccatgccatattcccaaccaatgatcaatcttccaaaccactttgccaatttgatgagttggtggcaggacagtcatactatttattgc |
18245360 |
T |
 |
| Q |
301 |
cgatgactgtcctatcacc |
319 |
Q |
| |
|
| ||||||||||| ||||| |
|
|
| T |
18245361 |
ctatgactgtcctgtcacc |
18245379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University