View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17883_high_35 (Length: 237)
Name: NF17883_high_35
Description: NF17883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17883_high_35 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 17 - 237
Target Start/End: Original strand, 4632833 - 4633053
Alignment:
| Q |
17 |
gatcacatttgtcgtcatcactaatcagccaaactatgaagatacaacaaaaatattattcaagaaagcaaataaggaaaagtagaagatattgcagcca |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
4632833 |
gatcacatttgtcgtcatcactaatcagccaaactatgaagatacaacaaaaatattattcaagaaagcaaataaggaaaagtggaagatatttcagcca |
4632932 |
T |
 |
| Q |
117 |
atcaacttctctatgtcatatatgttctgctaaagctccaaatttgcttcttaatcatttgactctaaatttgctaaataatttgatgcatctatttaca |
216 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4632933 |
atcaacttctctatgtcatatatgttccgctaaagctccaaatttgcttcttaatcatttgactctaaatttgctaaataatttgatgcatctatttaca |
4633032 |
T |
 |
| Q |
217 |
tttagtccacaaccatattcc |
237 |
Q |
| |
|
|||||||||||| |||||||| |
|
|
| T |
4633033 |
tttagtccacaaacatattcc |
4633053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 58 - 140
Target Start/End: Complemental strand, 10169076 - 10168994
Alignment:
| Q |
58 |
atacaacaaaaatattattcaagaaagcaaataaggaaaagtagaagatattgcagccaatcaacttctctatgtcatatatg |
140 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10169076 |
atacaacaaaaatattattcaaaaaaacaaataaggaaaattagaagatattgcagccaatcaacttctctatgtcatatatg |
10168994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 164 - 212
Target Start/End: Complemental strand, 12534323 - 12534275
Alignment:
| Q |
164 |
ttcttaatcatttgactctaaatttgctaaataatttgatgcatctatt |
212 |
Q |
| |
|
|||||||| |||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
12534323 |
ttcttaattatttgactctaaatttgcctagcaatttgatgcatctatt |
12534275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University