View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17883_low_14 (Length: 413)
Name: NF17883_low_14
Description: NF17883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17883_low_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 152; Significance: 2e-80; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 236 - 395
Target Start/End: Original strand, 42445187 - 42445346
Alignment:
| Q |
236 |
ttattcgtgtaacacgcgagacaatcgctaccgacctactcgaggaagaaagtacgcaaaaatgaatctaaagttctaaaccctttcttccctctctcaa |
335 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
42445187 |
ttattcgtgtaacacgcgagacaatcgctaccgacctactcgaggaagaaaatacgcaaaaatgaatctgaagttctaaaccctttcttccctctctcaa |
42445286 |
T |
|
| Q |
336 |
aatttctcattccctcgcaggttagtggttattttcactctctcattctaccgcatcttt |
395 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42445287 |
aatttctcattccctcgcaggttagtggttattttcactctctcattctaccgcatcttt |
42445346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 1 - 182
Target Start/End: Original strand, 42444937 - 42445121
Alignment:
| Q |
1 |
actttttatggttaatatacaatattcataattatctgtgtgagtataacttaattaacaaggacgctagtaacctatcgataagaaatttgtc--tttt |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42444937 |
actttttatggttaatatacaatattcataattatatgtgtgagtataacttacttaacaaggacgctagtaacctatcgataagaaatttgtctttttt |
42445036 |
T |
|
| Q |
99 |
ttaaaatagataaaaggggtgctcttgagttaagcttaggaagagatccaaattgtttatta-tttatattaaaaccaatgatga |
182 |
Q |
| |
|
||||||| |||||||||||||||| || ||||||||| ||||| ||||||| ||||||||| ||||| |||||| ||||||||| |
|
|
| T |
42445037 |
ttaaaatgaataaaaggggtgctctagaattaagcttaagaagacatccaaactgtttattactttatcttaaaatcaatgatga |
42445121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University