View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17883_low_18 (Length: 377)
Name: NF17883_low_18
Description: NF17883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17883_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 77; Significance: 1e-35; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 102 - 234
Target Start/End: Complemental strand, 5279186 - 5279054
Alignment:
| Q |
102 |
aaaaggacttgcatcgattatgacgattgacatctcaactctattttcaagctactaaaatacaannnnnnnngttgaaaaaatacggatcatagtacga |
201 |
Q |
| |
|
|||| ||||||||| |||||||||| |||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
5279186 |
aaaaagacttgcattgattatgacggttgatatctcaactctattttcaagctactaaaatacaattttttttgttgaaaaaatacggatcatagtacga |
5279087 |
T |
 |
| Q |
202 |
tattttaacatctcatttataccagcactttaa |
234 |
Q |
| |
|
| |||| ||||| ||||||||||| |||||||| |
|
|
| T |
5279086 |
tgttttgacatcccatttataccatcactttaa |
5279054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 10 - 95
Target Start/End: Complemental strand, 5279440 - 5279355
Alignment:
| Q |
10 |
agtagcaaagggtggtcgaaatccattataataaggaagttcaattgcaaaacaaagcataactaggaccagtttatgacattagg |
95 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
5279440 |
agtaacaaagggtggtcgaaatccattgaaataaggaagttcaattgcaaaacaaagcaaaactaggaccagtttatgacattagg |
5279355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 278 - 313
Target Start/End: Complemental strand, 5278644 - 5278609
Alignment:
| Q |
278 |
gttggggagccgaaccaaatctaacaaagctaagta |
313 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5278644 |
gttggggagctgaaccaaatctaacaaagctaagta |
5278609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University