View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17883_low_23 (Length: 329)
Name: NF17883_low_23
Description: NF17883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17883_low_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 100; Significance: 2e-49; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 17 - 227
Target Start/End: Original strand, 28618059 - 28618276
Alignment:
| Q |
17 |
gaagttggaatctcacccatgtttcacatgatgttttaatatttaaccaataaaaaatattcttggaagaatttccttctggtatttatgttatgtgctc |
116 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||| |||||||||| | ||||| |||| || ||||||||| ||| |||| |||| || |
|
|
| T |
28618059 |
gaagttggaatctcacccatatttcacatgatgttttaatatttaagcaataaaaaa-agtcttg-aagacttcccttctggtgtttctgttttgtggtc |
28618156 |
T |
 |
| Q |
117 |
acattgctgtactgcctattgtatcttatgcggtgtatgtcagattggttttgctgctcagagatatcttatcttc---------gagttcgtctctctt |
207 |
Q |
| |
|
|||||||||| ||||||||| ||||||||| |||||||||||| | ||||| ||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
28618157 |
acattgctgtgctgcctattttatcttatgttgtgtatgtcagaatagttttcctgctcagagatatcttatcttctaggactaggaattcgtctctctt |
28618256 |
T |
 |
| Q |
208 |
gttgccttgtcttccatgta |
227 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
28618257 |
tttgccttgtcttccatgta |
28618276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 15 - 73
Target Start/End: Original strand, 28615900 - 28615958
Alignment:
| Q |
15 |
atgaagttggaatctcacccatgtttcacatgatgttttaatatttaaccaataaaaaa |
73 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28615900 |
atgatgttggaatctcacccatgtttcacatgatgttttaatatttaaccaataaaaaa |
28615958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 149 - 227
Target Start/End: Original strand, 28616283 - 28616370
Alignment:
| Q |
149 |
gtgtatgtcagattggttttgctgctcagagatatcttatcttc---------gagttcgtctctcttgttgccttgtcttccatgta |
227 |
Q |
| |
|
|||||| |||||||| ||||||||| |||||||||||||||||| |||||| |||||||||||||||||||||||||||| |
|
|
| T |
28616283 |
gtgtatatcagattgattttgctgcacagagatatcttatcttctagaactaggagttcatctctcttgttgccttgtcttccatgta |
28616370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University