View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17883_low_36 (Length: 247)
Name: NF17883_low_36
Description: NF17883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17883_low_36 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 21 - 231
Target Start/End: Complemental strand, 55071210 - 55071000
Alignment:
| Q |
21 |
ttgtgaattttgtttaggttgggttcctttttaccgtggaaacagatgctaataatagtagctttgactagtttattttttcttccttcaacgaagtcga |
120 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| || ||||||||||||||| |
|
|
| T |
55071210 |
ttgtaaattttgtttaggttgggttcctttttaccgtggaaacagatgctaataatagtagctttgactagttttttttttttttcttcaacgaagtcga |
55071111 |
T |
 |
| Q |
121 |
tcannnnnnnaatagagtacatcttacatgtttatgtagccaattatgttgagtcggtatgcatccggacacactctccacaacatatggcgatcttttt |
220 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55071110 |
tcatttttttaatagagtacatcttacatgtttatgtagccaattatgttgagtcggtatgcatccggacacactctccacaacatatggcgatcttttt |
55071011 |
T |
 |
| Q |
221 |
tatgtccacat |
231 |
Q |
| |
|
||||||||| |
|
|
| T |
55071010 |
gttgtccacat |
55071000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University