View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17884_low_10 (Length: 237)
Name: NF17884_low_10
Description: NF17884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17884_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 109 - 217
Target Start/End: Original strand, 5713814 - 5713922
Alignment:
| Q |
109 |
agaattcaatatattttcttaaataatagtatcttaaatttgaagatgcttcggaatatacagaagcaaaaggaggatcttttcgatcttgaacagtatc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5713814 |
agaattcaatatattttcttaaataatagtatcttaaatttgaagatgcttcggaatatacagaagcaaaaggaggatcttttcgatcttgaacagtatc |
5713913 |
T |
 |
| Q |
209 |
ttatccatg |
217 |
Q |
| |
|
||||||||| |
|
|
| T |
5713914 |
ttatccatg |
5713922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 21 - 70
Target Start/End: Original strand, 5713756 - 5713805
Alignment:
| Q |
21 |
tccattaaagaattgttcccaatattgcaagaatagaaactagggtgaaa |
70 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
5713756 |
tccattaaagaattgttccacatattgcaagaatagaaactagggtgaaa |
5713805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University