View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17885_high_15 (Length: 258)
Name: NF17885_high_15
Description: NF17885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17885_high_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 18 - 249
Target Start/End: Complemental strand, 12598683 - 12598452
Alignment:
| Q |
18 |
ccttgcagcatcagtgttggtgtaagcattagaagaagcagtggatgggccataagcgaaatggcgcttccttgcagcattataatatccagtgttggca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12598683 |
ccttgcagcatcagtgttggtgtaagcattagaagaagcagtggatgggccataagcgaaatggcgcttccttgcagcattataatatccagtgttggca |
12598584 |
T |
 |
| Q |
118 |
gcagcattggttggtgttagactgtgaagaaacctacaagggtttctgttgcatctcccagcaagccagtaggtgcacgttgtattaatggttgtaggtt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
12598583 |
gcagcattggttggtgttagactgtgaagaaacctacaagggtttctgttgcatctcccagcaagccagtaggtgcatgttgtattaatggttgtaggtt |
12598484 |
T |
 |
| Q |
218 |
tagttgttctatcgctactatccatgatgatg |
249 |
Q |
| |
|
||||||||||| ||||||||||||||| |||| |
|
|
| T |
12598483 |
tagttgttctaccgctactatccatgacgatg |
12598452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 77 - 185
Target Start/End: Original strand, 11045354 - 11045471
Alignment:
| Q |
77 |
aatggcgcttccttgcagcattataatatccagtgttggcagca---------gcattggttggtgttagactgtgaagaaacctacaagggtttctgtt |
167 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||| |||||||||| ||| | | ||||| || ||| ||||||||||||||||| |||||||| |
|
|
| T |
11045354 |
aatgccgcttccttgcagcattatgatatccagcgttggcagcattgcaggaagcagtcgatggtgctacactatgaagaaacctacaaggatttctgtt |
11045453 |
T |
 |
| Q |
168 |
gcatctcccagcaagcca |
185 |
Q |
| |
|
|||| ||||||| ||||| |
|
|
| T |
11045454 |
gcatttcccagcgagcca |
11045471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University