View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17885_low_13 (Length: 279)
Name: NF17885_low_13
Description: NF17885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17885_low_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 10 - 264
Target Start/End: Complemental strand, 27874581 - 27874327
Alignment:
| Q |
10 |
agatgaagaatatgaaggcgatgttgctgaaatcgacgatttcaagaatgttgatctttttcttattggttctttttcagctctttcaagtgctgatttc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27874581 |
agatgaagaatatgaaggcgatgttgctgaaatcgacgatttcaagaatgttgatctttttcttattggttctttttcagctctttcaagtgctgatttc |
27874482 |
T |
|
| Q |
110 |
actttgtcaagagtgcacacactttggtaattgcttgttggtaaggcagatgaaacaagttttaggtctaaatttgattcatcaaaaagattcaatggaa |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
27874481 |
actttgtcaagagtgcacacactttggtaattgcttgttggtaaagcagatgaaacaagttttaggtctaaatttgattcatcaaaaaggttcaatggaa |
27874382 |
T |
|
| Q |
210 |
catttgattgtgttgatggaaaattcaagtcttgaagttttggtggtgttgattt |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27874381 |
catttgattgtgttgatggaaaattcaagtcttgaagttttggtggtgttgattt |
27874327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University