View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17885_low_20 (Length: 247)

Name: NF17885_low_20
Description: NF17885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17885_low_20
NF17885_low_20
[»] chr4 (1 HSPs)
chr4 (1-232)||(52166110-52166341)
[»] chr2 (1 HSPs)
chr2 (9-231)||(42664026-42664248)


Alignment Details
Target: chr4 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 52166110 - 52166341
Alignment:
1 gtgcacaagctgcaaatgcaaatcctttgtatttgtattataagaatggttggaaagagtttaaagcaattaaagccgaaacaacttttgcttctgctat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52166110 gtgcacaagctgcaaatgcaaatcctttgtatttgtattataagaatggttggaaagagtttaaagcaattaaagccgaaacaacttttgcttctgctat 52166209  T
101 tcaaattggtgatcctgtttcaattgatagagctgtttatgcattgaagaattctgatgggattgttgaggaagctagtgaagaggaattgatggatgca 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52166210 tcaaattggtgatcctgtttcaattgatagagctgtttatgcattgaagaattctgatgggattgttgaggaagctagtgaagaggaattgatggatgca 52166309  T
201 atggcacttgctgattcaactggaatgtttat 232  Q
    ||||||||||||||||||||||||||||||||    
52166310 atggcacttgctgattcaactggaatgtttat 52166341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 9 - 231
Target Start/End: Original strand, 42664026 - 42664248
Alignment:
9 gctgcaaatgcaaatcctttgtatttgtattataagaatggttggaaagagtttaaagcaattaaagccgaaacaacttttgcttctgctattcaaattg 108  Q
    ||||| ||||| ||||| ||||||||||||| ||||   || |||||||||||||| ||| | |  ||  |||| |||||||| |||||||| || || |    
42664026 gctgccaatgcgaatccgttgtatttgtattttaagtcggggtggaaagagtttaaggcagtgagggcacaaactacttttgcatctgctatacagatcg 42664125  T
109 gtgatcctgtttcaattgatagagctgtttatgcattgaagaattctgatgggattgttgaggaagctagtgaagaggaattgatggatgcaatggcact 208  Q
    ||||||| ||||| ||||||||||||||| |||| |||||||| |   ||||||||||||||||||||| ||| ||||||||||||||||| ||||| |     
42664126 gtgatccggtttctattgatagagctgttcatgctttgaagaactgcaatgggattgttgaggaagctactgaggaggaattgatggatgctatggctca 42664225  T
209 tgctgattcaactggaatgttta 231  Q
     |||||||| || || |||||||    
42664226 agctgattcgacggggatgttta 42664248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University