View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17885_low_24 (Length: 211)
Name: NF17885_low_24
Description: NF17885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17885_low_24 |
 | |
|
| [»] scaffold0330 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0330 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: scaffold0330
Description:
Target: scaffold0330; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 1 - 195
Target Start/End: Original strand, 4750 - 4953
Alignment:
| Q |
1 |
aataacatataaagcagcaagttcttctttgtcttagagaaaaccctaacactaacaattgaatgcaaa---------ttcnnnnnnngaactttgtaaa |
91 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
4750 |
aataacatataaagcagcaagttgttctttgtcttagagaaaaacctaacactaacaattgaatgcaacgtaaatcttttctttttttgaactttgtaaa |
4849 |
T |
|
| Q |
92 |
tgactataatttgacttaaaagaaaaattattttaataaaatattcatatacaattgtaatatgattctaaattgaaattatataaataaacaaaagttt |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4850 |
tgactataatttgacttaaaagaaaaattattttaataaaatattcatatacaattgtaatatgattctaaattgaaattacataaataaacaaaagttt |
4949 |
T |
|
| Q |
192 |
ttgg |
195 |
Q |
| |
|
|||| |
|
|
| T |
4950 |
ttgg |
4953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 45; Significance: 8e-17; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 3 - 63
Target Start/End: Complemental strand, 34384244 - 34384184
Alignment:
| Q |
3 |
taacatataaagcagcaagttcttctttgtcttagagaaaaccctaacactaacaattgaa |
63 |
Q |
| |
|
||||||||||| ||||| ||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
34384244 |
taacatataaatcagcatgttcttcttcgtcttagacaaaaccctaacactaacaattgaa |
34384184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University