View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17885_low_8 (Length: 374)
Name: NF17885_low_8
Description: NF17885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17885_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 50; Significance: 2e-19; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 17 - 70
Target Start/End: Original strand, 6627229 - 6627282
Alignment:
| Q |
17 |
aaatagtgtatcaaatatccctgcaacttaatttttatcatataaattgctctt |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
6627229 |
aaatagtgtatcaaatatccctgcaacttaatttttatcatgtaaattgctctt |
6627282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 17 - 70
Target Start/End: Original strand, 6635028 - 6635081
Alignment:
| Q |
17 |
aaatagtgtatcaaatatccctgcaacttaatttttatcatataaattgctctt |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
6635028 |
aaatagtgtatcaaatatccctgcaacttaatttttatcatgtaaattgctctt |
6635081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University