View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17886_high_12 (Length: 383)

Name: NF17886_high_12
Description: NF17886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17886_high_12
NF17886_high_12
[»] chr2 (1 HSPs)
chr2 (192-258)||(18800090-18800155)
[»] chr3 (2 HSPs)
chr3 (330-372)||(20383453-20383495)
chr3 (57-105)||(19412717-19412765)


Alignment Details
Target: chr2 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 192 - 258
Target Start/End: Original strand, 18800090 - 18800155
Alignment:
192 gctaaattgaattataactcacaacacaacactttaattcaaattggccaatgcttccattcccatc 258  Q
    |||||||||||||| || |||||||||| ||| |||||||||||||||| |||||||||||||||||    
18800090 gctaaattgaattacaattcacaacacaccacattaattcaaattggcc-atgcttccattcccatc 18800155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 330 - 372
Target Start/End: Complemental strand, 20383495 - 20383453
Alignment:
330 aaaacgtaacccacaactacctcttcaaatcttggaaccttca 372  Q
    |||||||||||||||||||||||||||| ||||||||||||||    
20383495 aaaacgtaacccacaactacctcttcaattcttggaaccttca 20383453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 57 - 105
Target Start/End: Original strand, 19412717 - 19412765
Alignment:
57 tacacgatacagttgtgtataacaactaactaacaaacagttaaaacta 105  Q
    |||| |||| |||||||| ||||||||||||||||| | ||||||||||    
19412717 tacaagatagagttgtgtttaacaactaactaacaagctgttaaaacta 19412765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University