View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17886_low_21 (Length: 312)
Name: NF17886_low_21
Description: NF17886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17886_low_21 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 211; Significance: 1e-115; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 22 - 304
Target Start/End: Original strand, 39150880 - 39151151
Alignment:
| Q |
22 |
cagtggtgagtgctgcttctagcatgggatccggtaacatggatttgggtgaagaattggagctaatcccccaagaagcatcactagaagcattcaggga |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
39150880 |
cagtggtgagtgctgcttctagcatgggatccggtaacatggatttgggtgaagaattggagctaatcccccaagaa------------gcattcaggga |
39150967 |
T |
|
| Q |
122 |
catagcatctgcacctttctagctatactcaaattgaatatacatgctcactcaacaagtgttcatgatcttttgaacttagttgtagcttgtac----a |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
39150968 |
catagcatctgcacctttctagctatactcaaattgaatatacatgctcactcaacaagtgttcatgatcttttgaacttagttgtagcttgtacatata |
39151067 |
T |
|
| Q |
218 |
tatatatatagtatgccatatgataccatacgggatgaaattttgggtttccaacaattattttttatcattatctcttttcatctc |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
39151068 |
tatatatatagtatgccatatgataccatacgggatgaaattttgggtttccaacaattattatttatc---atctcttttcatctc |
39151151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University