View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17886_low_25 (Length: 290)
Name: NF17886_low_25
Description: NF17886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17886_low_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 152; Significance: 2e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 102 - 272
Target Start/End: Complemental strand, 38843133 - 38842960
Alignment:
| Q |
102 |
ataagattgttaagtgttg---agtctcaagatatttgaagtcggaagaccacatagttaaagcaaacaattaatgagatttatgataggagactgcagc |
198 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38843133 |
ataagattgttaagtgttgttgagtctcaagatatttgaagtcggaagaccacatagttaaagcaaacaattaatgagatttatgataggagactgcagc |
38843034 |
T |
 |
| Q |
199 |
tgaaccactgtcacacatgacatgaaaaatacaaggctctaaagaaagattgatgaggccaacaaacgtgttta |
272 |
Q |
| |
|
||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38843033 |
tgaaccactatcccacatgacatgaaaaatacaaggctctaaagaaagattgatgaggccaacaaacgtgttta |
38842960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University